first previous next last contents

Printing the sites

From the Result manager ( see section Result manager), menu a pop-up menu for restriction sites results can be used to write the results in two forms to the the Output window - from here the results can be saved to a file. The two choices of format are "Output enzyme by enzyme" and "Output ordered on position", brief examples of which are shown below. Note that these listings are also available from gap4.

The restriction enzyme results output ordered "enzyme by enzyme". The enzymes sites are numbered and named and the actual cut site from the sequence is written, followed by the position of the cut, the fragment size, and finally a sorted list of fragment sizes.


  Matches found=     1 
      Name            Sequence                 Position Fragment lengths
    1 ApaLI           G'TGCAC                      3506   3505   3505 
                                                          4629   4629 
  Matches found=     8                         
      Name            Sequence                 Position Fragment lengths
    1 ApoI            A'AATTC                      1939   1938    184 
    2 ApoI            G'AATTT                      2632    693    339 
    3 ApoI            A'AATTT                      2996    364    364 
    4 ApoI            G'AATTC                      3180    184    419 
    5 ApoI            A'AATTT                      5283   2103    639 
    6 ApoI            G'AATTC                      5702    419    693 
    7 ApoI            A'AATTC                      6341    639   1455 
    8 ApoI            A'AATTC                      7796   1455   1938 
                                                           339   2103 
  Matches found=     2                         
      Name            Sequence                 Position Fragment lengths
    1 AseI            AT'TAAT                      1790   1789    435 
    2 AseI            AT'TAAT                      2225    435   1789 
                                                          5910   5910 

The restriction enzyme results output ordered on position. The enzymes sites are numbered and named and the actual cut site from the sequence is written, followed by the position of the cut, the fragment size, and finally a sorted list of cut sizes.


============================================================
Wed 19 Nov 15:42:38 1997: Restriction enzymes result list
------------------------------------------------------------
Sequence /nfs/skye/home10/rs/work/doc/nip4/atpase.dat
Number of enzymes = 80
Number of matches = 597
      Name            Sequence                 Position Fragment lengths
    1 AspLEI          GCG'C                         157    156      0 
    2 AccII           CG'CG                         313    156      0 
    3 AspLEI          GCG'C                         313      0      0 
    4 AviII           TGC'GCA                       322      9      0 
    5 AspLEI          GCG'C                         323      1      0 
    6 AsuHPI          'CGCTTTATCACC                 342     19      0 
    7 AflIII          A'CGCGT                       362     20      0 
    8 AccII           CG'CG                         364      2      0 
    9 BcgI            'AACAGGGTTAGCAGAAAAGTCG       389     25      0 
   10 BcgI            GCAGAAAAGTCGCAATTGTATGCA'     423     34      0 
   11 AsuHPI          'CATTTATTCACC                 440     17      0 
   12 AspLEI          GCG'C                         486     46      0 
   13 AciI            C'CGC                         502     16      0 
   14 AciI            G'CGG                         552     50      0 
   15 AccII           CG'CG                         552      0      0 
   16 AclI            AA'CGTT                       614     62      0 


first previous next last contents
This page is maintained by James Bonfield. Last generated on 2 Febuary 1999.
URL: http://www.mrc-lmb.cam.ac.uk/pubseq/manual/nip4_19.html